TARGETRONICS, LLC

is dedicated to TargeTron (group II intron RNA) design, support, and innovation

TargeTronics, LLC

Menu

TargeTron Resources
Introduction
Construction (Retargeting)
PCR Templates & Primer Mix
Gene Targeting
Frequently Asked Questions
References

TargeTron Vectors
LtrB TargeTron Vectors
EcI5 TargeTron Vectors

TargeTron Design
Purchase Subscription
LtrB Intron Design
EcI5 Intron Design

Free Examples
TargeTron Design

Legal Information
TargeTron Limited Label License
TargeTron
gBlock

Enzyme sequence for the IBS primer/gBlock

The enzyme sequence (shown as XbaI) will be at the 5'- end of the retargeted PCR product or gBlock

Example:

IBS1/2S      CCCCTCTAGAAGAATTCCCATGCCAAACTGGTGCTCGAATGTGCGACATGAAGTCG

gBlock      CCCCTCTAGAAGAATTCCCATGCCAAACTGGTGCTCGAATGTGCGA . . . etc.

Primer for gBlock extension (required):

EcI5-F      CCCCTCTAGAAGAATTCCCATGCCAAA