TARGETRONICS, LLC

is dedicated to TargeTron (group II intron RNA) design, support, and innovation

TargeTronics, LLC

Menu

TargeTron Resources
Introduction
Construction (Retargeting)
PCR Templates & Primer Mix
Gene Targeting
Frequently Asked Questions
References

TargeTron Vectors
LtrB TargeTron Vectors
EcI5 TargeTron Vectors

TargeTron Design
Purchase Subscription
LtrB Intron Design
EcI5 Intron Design

Free Examples
TargeTron Design

Legal Information
TargeTron Limited Label License
TargeTron
gBlock

Sequence File Formats

DNA sequence files must be in plain ASCII format. No HTML, Word.doc or .rtf formats are allowed. The input file can be in GenBank or FASTA format, as well as a simple text format. Both lower case and caps are allowed, a comment line starting with a > is ignored. Please look at the examples below.


GenBank format :
               
        1 aagcctaact cttttgaatc tatttttcca tttttcgttt tgaaaaaaat atgccgtaat
       61 tcttcctaaa tcgtcttatt ttgcgtgttt tggtctgttc cttgtcattg tcctagaaat
      121 tatttaaaat gcaatacaag ccaatctgtg agcttaaagg ggtattatat agcagggcgt
      181 acttcatcaa caaccaaaca aaaaaaccac tcttgattga gtggcgtgta aatgaagaga
      241 tacctcactt ttctatttta ttaaattttg ttcattgata gtttcaattg cttttttaac
      301 ttgttcaggt ttaccagtta taactaactt tatttcatct ttacgttcgg cgtgtttctt
      361 tcctacttta attaagtacc aactgtacaa gatgaatgac acaatataaa taacgtatac
      421 tatttttaca cctccgtcat ttcttctaac gtttcttcta ctgttttatg taagtcgtag
      481 tagaatacac cagtataatg tttgtcttct tctttggtcc aattttcata atcggtatct
      541 tccatgattt cgttgaccat ttcagaatgt tcgtttaggt tagtcacaag aatttcaacg
      601 gcttttacag aggctttgtg ccattttgcc gtgaattcgt acgctttgac aacttcttga
      661 agcatactga acaagtcaat gtattgggct tcagcataag cgtggacttg actttcatct
      721 tttggaaaat gttcatctac ttttttatca tgtaatttca aagtgtcact aagcaattca
      781 atttggtttt ttaatttcat ttttttattt ctctctttct ttttacactt gcattccagt
      841 taatttgttt aagtatttcg ttttgcggtc ga
//  

FASTA format :

>gi|1146276|gb|L48605.1|C2PVCG Bacteriophage c2 complete genome
AAGCCTAACTCTTTTGAATCTATTTTTCCATTTTTCGTTTTGAAAAAAATATGCCGTAATTCTTCCTAAA
TCGTCTTATTTTGCGTGTTTTGGTCTGTTCCTTGTCATTGTCCTAGAAATTATTTAAAATGCAATACAAG
CCAATCTGTGAGCTTAAAGGGGTATTATATAGCAGGGCGTACTTCATCAACAACCAAACAAAAAAACCAC
TCTTGATTGAGTGGCGTGTAAATGAAGAGATACCTCACTTTTCTATTTTATTAAATTTTGTTCATTGATA
GTTTCAATTGCTTTTTTAACTTGTTCAGGTTTACCAGTTATAACTAACTTTATTTCATCTTTACGTTCGG
CGTGTTTCTTTCCTACTTTAATTAAGTACCAACTGT

Simple text format :

AAGCCTaaCTCTTTTgaaTCTATTTTTccaTTTTTCGTTTTGaaaaaaaTATGCCGTAATTCTTCCTAAA 
TCGTCTTATTTTGCGTGTTTTGGTCTGTTCCTTGTCATTGTCCTAGAAATTATTTAAAATGCAATACAAG
CCAATCTGTGAGCTTAAAGGGGTATTATATAGCAGGGCGTACTTCATCAACAACCAAACAAAAAAACCAC
TCTTGATTGAGTGGCGTGTaaaTGAAGAGATACCTCACTTTTCTATTTTATTAAATTTTGTTCATTGATA
GTTTCAATTGCTTTTTTAACTTGTTCAGGTTTACCAGTTATAACTAACTTTATTTCATCTTTACGTTCGG
CGTGTTTCTTTCCTACTTTA